In 2006, a new variant of Chlamydia trachomatis was reported following an unexpected 25% decrease in the number of infections detected in Halland, Sweden.1 The cause was rapidly identified to be a 377 base pair deletion in the cryptic plasmid in a region targeted by the PCR-based detection systems Cobas Amplicor (Roche Diagnostics, Branchburg, USA), Cobas Taqman48 (Roche Diagnostics) and Abbott m2000 (Abbotts, Illinois, USA).2 These tests yield a false negative result while other nucleic acid amplification tests (NAATs) with other target regions still detect the new variant of C trachomatis. Initial data from different areas of Sweden showed that 39% of all chlamydia cases detected during one month were caused by the new variant of C trachomatis.3 The prevalence of the new variant of C trachomatis in Malmö, Sweden, 20 km from Copenhagen, is approximately 25% (K Persson, personal communication, 2008). In Denmark, the Roche tests cover about a third of the market, Becton Dickinson (ProbeTec (BD Diagnostics, Sparks, Massachusetts, USA) or Viper (Roche Molecular Diagnostics, Pleasanton, California, USA)) 50% and GenProbe (APTIMA CT/Combo, GenProbe, San Diego, California, USA) about 15%.4 Denmark is closely connected to Sweden with a bridge between Copenhagen and Malmö and by numerous ferry connections. In a recent report from Öresundskomiteen, it is estimated that 3500 people move from Denmark to Sweden every year and 1800 the other way.5 Every day about 17 000 people commute across the border: 90% towards Copenhagen.6 Considering this close contact between the two countries we aimed to determine how common the new variant of C trachomatis was in Denmark.

METHODS

During the summer of 2007, approximately 50 consecutive urine samples from each of the 14 participating laboratories were collected prospectively in Becton Dickinson urine preservative transport tubes. No information was available about the risk profile of the patients. However, since the vast majority of the specimens were from men, a large proportion would be from symptomatic individuals. At Statens Serum Institut all specimens were tested using an in-house real-time C trachomatis PCR assay targeting the 16S rRNA gene using primers Ctr-f GGATCTTAGGACCTTTCGGT; Ctr-r ATCTCTCAATCCGCCTAGACG; and probe Ctr MGB probe TET-AAGGGAGAGTCTATGTGATAT-MGB. The reaction conditions and internal amplification control were identical to those previously described for Mycoplasma genitalium real-time PCR.7 All positive results were confirmed using a gel-based PCR with primers CTP200/CTP201 flanking the plasmid deletion; thus, the new variant C trachomatis strains produced a 377 bp shorter amplicon than those of the wild type.2 All specimens were tested by Becton Dickinson ProbeTec (Viper platform). Specimens found positive at only one testing site were retested in a real-time PCR targeting the cryptic plasmid with primers Ctr-pl-482F GGATCCGTAAGTTAGACGAAATTTTG and Ctr-pl-564R TTTAATGCGAAAGGAAATCTGATTG and probe Ctr-pl-510 5′Yakima Yellow-TTTGCGCACAGACGATCTATTTTTTGCA-BHQ-1. Specimens found positive in any two assays were considered true positives (see table 1).

RESULTS

Altogether, 691 urine specimens (625 male and 66 female) were included in the study. Roche PCR (seven laboratories) had a true positive rate of 17% (n = 350 tested). Becton Dickinson ProbeTec C trachomatis assay (six laboratories) had a true positive rate of 16% (n = 291 tested). GenProbe Aptima C trachomatis assay (one laboratory) had a true positive rate of 12% (n = 50 tested). The positive rate for all 691 specimens tested at Statens Serum Institute was 17% and on the Viper platform at Hvidovre Hospital 17%. Only one specimen was positive for the new variant of C trachomatis giving a prevalence of 0.14% of all samples (95% CI 0.0 to 0.8%) or 0.8% of the positives (95% CI 0.02 to 4.5%). The single case found was from Bornholm, a Danish island in the Baltic Sea, which is predominantly connected to Denmark by a ferry from Sweden. Similarly, a very low prevalence has been reported from Norway, France and Ireland,8^–10 which are currently the only other countries reporting a new variant of C trachomatis.11

CONCLUSION

Considering the high prevalence in neighbouring Sweden, our low prevalence was surprising. No new variant of C trachomatis was found among the 350 samples from Zealand (connected by bridge to Sweden). This might be explained by the fact that the laboratories in the Copenhagen area with the closest contact to Sweden use the Becton Dickinson ProbeTec C trachomatis assay. Thus, the risk of “diagnostic selection pressure” on the new variant of C trachomatis is diminished. In the Olso area in Norway, 2.6% of the C trachomatis infections are caused by the new variant of C trachomatis and mostly found in patients with contact to Sweden (A Moghaddam and H Moi, personal communication). Whether this reflects a different pattern in the population mobility, with Swedes in Copenhagen commuting back to Sweden after work in contrast to Swedes staying in Oslo working for a longer period, is not clear.

Recently, a paper on spatial bridges and the spread of chlamydia has provided new insight in the dynamics of the infection. In Värmland County, Sweden, relatively close to the Norwegian border, tracing of contacts to 579 chlamydia positive patients allowed the description of sexual networks. In this study, spatial bridges were defined as individuals who reported two or more partners at least one of whom resided outside the county of Värmland.12 Of the 46 spatial bridges, 2 had contacts to Denmark and 16 to Norway (MK Nordvik, personal communication, 2008). Clearly, there is a high risk that this new strain may spread emphasising the need to coordinate chlamydia programmes above the local level.