Table 2

 Nucleotide sequences of HSV positive specimens with Tm >60°C. Probes are boxed and nucleotide differences are bold

SpecimenHSV-2 sequence
HSV-2 ControlCGGCGTCATCTGCGGGGGCAAGATGCTCATCAAGGGCGTG-GATCTG-GTGCGCAAAAAC
Probe LCRGGCGTCATCTGCGGGGGCAAG
Probe FLUGCTCATCAAGGGCGTG-GATCTG-GTGCGC
1CGGCGTCATCTGCGGGGGCAAGATGCTCATTAAGGGCGTC-GACCTG-GTGCGCAAAAAC
2CGGCGTCATCTGCGGGGGCAAGATGCTCATCAAGGGCGTG-GATCTG-GTGCGCAAAAAC
3CGGCGTCATCTGCGGGGGCAAGATGCTCATCAAGGGCGTG-GATCTG-GTGCGCAAAAAC
4CGGCGTCATCTGCGGGGGCAAGATGCTCATCAAGGGCGTG-GATCTG-GTGCGCAAAAAC
5CGGCGTCATCTGCGGGGGCAAGATGCTCATCAAGGGCGTG-GATCTG-GTGCGCAAAAAC
6CGGCGTCATCTGCGGGGGCAAGATGCTCATCAAGGGCGTG-GATCTG-GTGCGCAAAAAC
7CGGCGTCATCTGCGGGGGCAAGATGCTCATCAAGGGCGTG-GATCTG-GTGCGCAAAAAC
8CGGCGTCATCTGCGGGGGCAAGATGCTCATCAAGGGCGTG-GATCTG-GTGCGCAAAAAC
9CGGCGTCATCTGCGGGGGCAAGATGCTCATCAAGGGCGTG-GATCTG-GTGCGCAAAAAC
10CGGCGTCATCTGCGGGGGCAAGATGCTCATTAAGGGCGTC-GACCTG-GTGCGCAAAAAC
11CGGCGTCATCTGCGGGGGCAAGATGCTCATCAAGGGCGTG-GATCTG-GTGCGCAAAAAC
12CGGCGTCATCTGCGGGGGCAAGATGCTCATCAAGGGCGTG-GATCTG-GTGCGCAAAAAC
13CGGCGTCATCTGCGGGGGCAAGATGCTCATCAAGGGCGTGAGATCTG-GTGCGCAAA---
14CGGCGTCATCTGCGGGGGCAAGATGCTCATCAAGGGCGTG-GATCTGTGTGCGCAAAAAC